90
|
GenScript corporation
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)/product/GenScript corporation Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) 20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)/product/GenScript corporation Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |