guide rna sequence 5 Search Results


90
GenScript corporation tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)
Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)
20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results